$ 699.00+
Human CRISPR Deletion Library - Drug targets, kinases, phosphatases-Plasmid
Cat.No. Delivery Complimentary
  • Parameters
  • Detail
  • Cell Info
  • References
Price
$699.00

Detailed Product Information

This Human CRISPR Deletion Library - Drug targets, kinases, phosphatases targets 2333 genes in the human genome and contains a total of 24569 knockout plasmid vectors. Each gene is represented by 10 distinct gRNA vectors, and the library also includes 750 control vectors targeting intergenic regions. The library is based on the pMCB320 backbone, which is a dual-plasmid system capable of requiring separate expression of gRNA and Cas9.


Product Name

Human CRISPR Deletion Library - Drug targets, kinases, phosphatases

Species

Human

Library Type

Knockout Library

Plasmid System

Two-vector System

Virus Packaging System

3rd Lentivirus Packaging System

Targeted Genes

233310 gRNA per gene

Non-targeting gRNA Number

750

gRNA Number

24569

Selection Marker

Puro

Verification Primers

Forward prime: CAGCACAAAAGGAAACTCACC

Reverse primer: GCCTAATGGATCCTAGTACTCGAG

PCR Fragment: 226 bp

The primers are designed for PCR amplification of library fragments prior to NGS sequencing. The resulting amplicons can be purified and directly applied to subsequent NGS analysis.

Product Specifications

Ready-to-use, endotoxin-free Maxiprep plasmids, validated by next-generation sequencing, with coverage=98.99% and uniformity=5.51.

For research use only. Not intended for use in humans or animals, including but not limited to clinical trials, therapeutic, or diagnostic applications.


Backbone Map

pMCB320.png


CRISPRSeekTM Product Strength

CRISPRSeeKTM Product Strength.png

For product instructions, please refer to the [HySigen CRISPR Library Screening Technology Application Guide (2024–2025) ].


FAQs

Q: How to ensure sgRNA coverage during library plasmid amplification?

A: To maintain adequate sgRNA coverage, use highly efficient electrocompetent cells for transformation. The number of colonies should be at least 300 times the number of sgRNAs (colonies > sgRNA count × 300) to ensure that all sgRNAs are sufficiently represented in the amplified library.


Q: How to assess the coverage and uniformity of sgRNAs in library plasmids?

A: Coverage and distribution must be evaluated by next-generation sequencing (NGS). Specific primers should be designed flanking the sgRNA sequences, and high-fidelity polymerases should be used for amplification. The amplified products are then subjected to sequencing and data analysis to determine sgRNA coverage and uniformity.


Q: Why is solid medium generally used for library plasmid amplification instead of liquid culture?

A: This is mainly due to the consideration of plasmid stability during host cell growth and expansion. In most cases, compared with liquid culture, solid medium cultivation can better reduce the occurrence of plasmid recombination. Since recombined plasmids may affect downstream applications, we recommend controlling the cultivation method to ensure plasmid integrity.


Q: If plasmids are amplified on solid medium but recombination is still observed after extraction, what should be done?

A: Then we need to further optimize experimental details. For example, in the choice of competent cells, RecA-deficient strains can be selected to minimize recombination, such as the Stabl4 strain. Additionally, plasmid recovery and culture can be performed at appropriately lower temperatures, and it is recommended to try incubation at 30 °C.


Q: How to change the antibiotic resistance marker of library plasmids?

A: Unlike conventional plasmids, library plasmids cannot be directly modified to change the resistance marker, as this would cause significant sgRNA loss. Instead, the plasmid backbone should be modified first, and the sgRNA sequences re-integrated into the new backbone via homologous recombination.


Q: What should I do if the calculated sgRNA colony number is still very low after repeated electroporation?
A:
If the colony number remains very low after repeated experiments, then it is necessary to review the details of the amplification process. We recommend first checking whether the transformation efficiency of the competent cells has decreased, which can be evaluated by adding pUC19 plasmid as a positive control during transformation. In addition, if the experimental timeline is tight and all amplification batches of the library plasmid reach a coverage of more than 100 colonies per sgRNA, then it is also possible to combine different plasmid batches for subsequent experiments.


Q: For relatively small-scale libraries, such as sgRNA libraries with <1k sequences, can heat-shock transformation be used for amplification?
A:
For relatively small-scale libraries, chemical competent cells can be used for transformation, since the ultimate goal of the experiment is simply to obtain a library plasmid pool with sufficient sgRNA colony coverage. However, for medium- to large-scale libraries, we need to consider experimental efficiency, as electroporation is a more time-saving and efficient method of transformation.


Q: Since lower temperatures can reduce recombination, why don’t we culture at lower temperatures right from the start of amplification?
A:
This is mainly due to yield considerations. Lowering the culture temperature will significantly reduce plasmid yield. In addition, since we use solid medium for plasmid amplification, recombination rarely occurs in the recovered plasmids. Furthermore, it is generally better to produce a large stock of library plasmids in a single amplification experiment, which reduces batch-to-batch variation and provides more reliable reproducibility data for downstream experiments.


Q: What is the recommended fragment size for PCR amplification of library plasmids?

A: Standard sequencing uses PE150 (paired-end, 150 bp per read, total 300 bp). To ensure complete capture of sgRNA information, it is recommended that PCR amplicons not exceed 300 bp in length.


Q: Can library plasmids be directly used to generate library cells?

A: No. Library plasmids cannot directly establish library cell lines. When introduced via transient transfection, sgRNA sequences do not integrate into the genome, and editing events within the cells cannot be reliably tracked by NGS. Stable integration (e.g., via viral packaging) is required to construct functional library cell lines.


Relevant products and service

HySigen offers off-the-shelf libraries, including human and mouse genome-wide plasmid libraries as well as selected sub-libraries, along with one-stop customized screening services covering CRISPR-KO, CRISPRa, and CRISPRi. Our services include high-throughput sgRNA library construction, virus packaging, cell infection, drug screening, NGS sequencing, and data analysis. A variety of deliverables are available to meet diverse research needs. (CRISPRSeek library screening service)

Order