$ 2999.00+
Human CRISPR Deletion Library - Membrane proteins
Cat.No. Delivery Titer Complimentary
  • Parameters
  • Detail
  • Cell Info
  • References
Price
$2999.00

Detailed Product Information

HySigen CRISPR Library Virus is developed through the CRISPRSeek™ platform. The process begins with the preparation of library plasmids featuring high coverage and excellent uniformity. These plasmids are then efficiently packaged using a lentiviral packaging kit, after which the supernatant is collected, filtered, and concentrated to generate a high-titer CRISPR library virus.

Leveraging this platform, HySigen provides CRISPR library viruses that can be directly applied to the construction of stable CRISPR library cell pools, eliminating the need for the time-consuming and complex plasmid amplification step. This greatly streamlines experimental workflows and enhances overall efficiency.


Product Name

Human CRISPR Deletion Library - Membrane proteins

Species

Human

Library Type

Knockout Library

Plasmid System

Two-vector System

Virus Packaging System

3rd Lentivirus Packaging System

Targeted Genes

109810 gRNA per gene

Non-targeting gRNA Number

750

gRNA Number

12334

Selection Marker

Puro

Verification Primers

Forward prime: CAGCACAAAAGGAAACTCACC

Reverse primer: GCCTAATGGATCCTAGTACTCGAG

PCR Fragment: 226 bp

The primers are designed for PCR amplification of library fragments prior to NGS sequencing. The resulting amplicons can be purified and directly applied to subsequent NGS analysis.

Titer

≥1×108 TU/mL

Storage Condition

-80℃

For research use only. Not intended for use in humans or animals, including but not limited to clinical trials, therapeutic, or diagnostic applications.


Backbone Map

pMCB320.png


CRISPRSeekTM Product Strength

CRISPRSeeKTM Product Strength.png

For product instructions, please refer to the [HySigen CRISPR Library Screening Technology Application Guide (2024–2025) ].


Product Reception

(1) Storage and Transportation

HySigen’s CRISPR knockout library lentivirus is shipped on dry ice. Upon receipt, the virus should be stored at -80 °C, and repeated freeze–thaw cycles should be strictly avoided.

(2) Stability

When stored at –80 °C, the lentivirus remains stable for at least 6 months. If the storage period exceeds 6 months, it is recommended to reassess the viral titer prior to use to ensure optimal performance.


FAQs

Q: What are the differences between library virus packaging and conventional virus packaging?

A: Compared with conventional viral packaging, library virus packaging involves single-plasmid systems that typically have larger insert sizes, making the process more technically challenging. Furthermore, library viruses must be produced in larger volumes and often require bulk-scale packaging, necessitating specific adjustments and optimizations to the viral packaging system.


Q: What methods can be used to determine the titer of library viruses?
A:
Commonly used approaches for determining library virus titer include fluorescence-based counting, quantitative PCR (qPCR), and ELISA assays. These methods provide reliable and quantitative measurements for ensuring experimental consistency.


Q: What factors should be considered when infecting cells with library viruses?
A:
Unlike the generation of stable cell lines for gene overexpression, infection with library viruses requires strict control of the multiplicity of infection (MOI). Typically, an MOI is selected that achieves approximately 30% infection efficiency in the target cell population, ensuring that most cells carry a single viral integration and maintaining the integrity of the pooled library.


Q: Can library viruses be stored for extended periods?
A:
Library viruses carry a diverse collection of sgRNA sequences. Even under –80 °C storage, gradual degradation may occur, potentially leading to partial loss of sgRNA representation and affecting library coverage. Therefore, it is recommended that library viruses be stored for no longer than six months, and fresh virus stocks should be prepared as needed to ensure optimal performance.


Q: What is gRNA Coverage?

When generating stable cell pools, gRNA coverage refers to the ratio between the total number of cells and the total number of gRNAs following library virus transduction and antibiotic selection.

For example, given a library containing 65,383 gRNAs, if a coverage of 500× is required, the total number of cells after transduction and antibiotic selection must exceed 3.27 × 10⁷. Considering that only ~30% of cells typically survive antibiotic selection, the initial number of cells at the time of infection should be approximately 1.09 × 10⁸ to ensure sufficient coverage.


Q: How to Prepare NGS Sequencing Samples?

A: NGS sequencing samples can be prepared from cells, genomic DNA, PCR products, or constructed sequencing libraries.

(1) Cell Samples

Resuspend cells in PBS, centrifuge, and discard the supernatant. Collect the cell pellet and ship it on dry ice. The total number of cells should be ≥ number of gRNAs × required coverage.

(2) Genomic DNA

Prepare cell pellets as above, then extract genomic DNA using the appropriate kit. DNA concentration and total yield should meet the requirements specified by the sequencing provider.

(3) PCR Products

Amplify gRNAs from genomic DNA using gRNA-specific primers (excluding sequencing adapters and universal primers). Purify PCR products, then adjust concentration and yield according to the sequencing company’s specifications.

(4) Sequencing Library

This option is not recommended, as self-constructed libraries may exhibit low compatibility with sequencing platforms.


Relevant products and service

HySigen offers off-the-shelf libraries, including human and mouse genome-wide plasmid libraries as well as selected sub-libraries, along with one-stop customized screening services covering CRISPR-KO, CRISPRa, and CRISPRi. Our services include high-throughput sgRNA library construction, virus packaging, cell infection, drug screening, NGS sequencing, and data analysis. A variety of deliverables are available to meet diverse research needs. (CRISPRSeek library screening service)


Order